SciELO - Scientific Electronic Library Online

 
vol.1 número3Indicadores epidemiológicos da leishmaniose tegumentar americana, no período de 1999 a 2008, no Estado de Alagoas, BrasilMétodos para avaliação da atividade antimalárica nas diferentes fases do ciclo de vida do Plasmodium índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

  • Não possue artigos citadosCitado por SciELO

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Revista Pan-Amazônica de Saúde

versão On-line ISSN 2176-6223

Rev Pan-Amaz Saude v.1 n.3 Ananindeua set. 2010

http://dx.doi.org/10.5123/S2176-62232010000300014 

ARTIGO ORIGINAL | ORIGINAL ARTICLE | ARTÍCULO ORIGINAL

 

Soroprevalência do vírus linfotrópico de células T humanas em comunidades ribeirinhas da região nordeste do Estado do Pará, Brasil

 

Human T-lymphotropic virus seroprevalence in riparian communities in the northeastern region of Pará State, Brazil

 

Seroprevalencia del virus linfotrópico de células T humanas en comunidades ribereñas de la región nordeste del Estado de Pará, Brasil

 

 

Louise de Souza Canto FerreiraI; Jaqueline Helen Godinho CostaII; Carlos Araújo da CostaIII; Marly de Fátima Carvalho de MeloIV; Marizete Lopes AndradeV; Luisa Carício MartinsIII; Edna Aoba Yassui IshikawaIII; Maisa Silva de SousaIII

IFaculdade de Farmácia, Centro Universitário do Pará, Belém, Pará, Brasil
IIFaculdade de Ciências Biológicas, Instituto de Ciências da Saúde, Universidade Federal do Pará, Belém, Pará, Brasil
IIINúcleo de Medicina Tropical, Universidade Federal do Pará, Belém, Pará, Brasil
IVPrograma Luz na Amazônia, Faculdade de Farmácia, Instituto de Ciências da Saúde, Universidade Federal do Pará, Belém, Pará, Brasil
VPrograma Luz na Amazônia, Sociedade Bíblica do Brasil, Belém, Pará, Brasil

Endereço para correspondência
Correspondence
Dirección para correspondencia

 

 


RESUMO

O vírus-T linfotrópico humano do tipo 1 (HTLV-1) foi o primeiro retrovírus humano a ser identificado e está associado a várias doenças debilitantes. O Estado do Pará é o terceiro do Brasil com maior frequência de infecção por HTLV entre doadores de sangue. As comunidades ribeirinhas são carentes de ações de educação e assistência à saúde, pela característica de terem moradias espalhadas ao longo de furos e pela dificuldade de acesso aos centros urbanos. Este estudo objetivou investigar a infecção causada pelo HTLV em comunidades ribeirinhas do nordeste paraense, atendidas pelo Programa Luz na Amazônia, entre fevereiro de 2009 e junho de 2010. Pesquisa de anticorpos anti-HTLV-1/2 foi realizada em 175 ribeirinhos, sendo 30 (17,14%) da comunidade de São Pedro (Acará); 62 (35,43%) da comunidade do Furo do Aurá (Belém) e 83 (47,43%) de Santa Maria (Acará). Nos casos reagentes, métodos de biologia molecular foram utilizados para confirmação da infecção e identificação do tipo viral. A prevalência total do HTLV-1 foi de 1,14% (2/175), variando entre zero (0/34) em São Pedro, 1,20% (1/83) em Santa Maria e 1,61% (1/62) no Furo do Aurá. O HTLV-1 foi identificado em duas das 117 (1,71%) famílias analisadas das três comunidades. Não foi observado nenhum caso de transmissão familiar na amostra. O HTLV-2 não foi encontrado na amostra estudada. Este estudo demonstrou a ocorrência de HTLV-1 nas comunidades ribeirinhas estudadas, com frequências semelhantes às de populações urbanas, indicando a necessidade de maior investigação e ações de prevenção das doenças associadas ao vírus nessas comunidades.

Palavras-chave: Deltaretrovirus; Estudos Transversais; Estudos Soroepidemiológicos; ELISA.


ABSTRACT

The human T-lymphotropic virus 1 (HTLV-1) was the first human retrovirus identified, and it is associated with several debilitating diseases. Pará State has the third highest frequency rate of HTLC infections among blood donors in Brazil. Its riparian communities lack educational policies and health care assistance mainly because they inhabit "furos" (Amazonian river channels) and do not have easy access to urban centers. This study aimed to investigate the infection by HTLV in riparian communities of northeastern Pará included in the Luz na Amazônia Program between February 2009 and June 2010. A total of 175 riparian individuals were selected for detection of anti-HTLV-1/2 antibodies: 30 from the São Pedro community (Municipality of Acará), 62 from the Furo do Aurá Community (Municipality of Belém), and 83 from Santa Maria (Municipality of Acará). In the HTLV-reactive individuals we used molecular methods to confirm infection and identify the viral type. HTLV-2 was not found in the study samples. The overall prevalence of HTLV-1 was 1.14% (2/1 75), ranging from zero (0/34) in São Pedro to 1.20% (1/83) in Santa Maria and 1.61 % (1/62) in Furo do Aurá. HTLV-1 was identified in two of 117 (1.35%) families from all three communities. We reported no evidence of familial transmission through testing of samples. HTLV-2 was not found in the samples tested. This study demonstrates the occurrence of HTLV-1 in the riparian communities studied, with frequency rates similar to those of urban populations, which warrants further research and actions to prevent diseases associated with HTLV in these communities.

Keywords: Deltaretrovirus; Cross-Sectional Studies; Seroepidemiologic Studies; Enzyme-Linked Immunosorbent Assay.


RESUMEN

El virus-T linfotrópico humano del tipo 1 (HTLV-1) fue el primer retrovirus humano a ser identificado y está asociado a varias enfermedades debilitantes. El Estado de Pará es el tercero de Brasil con mayor frecuencia de la infección por HTLV entre donantes de sangre. Las comunidades ribereñas carecen de acciones de educación y asistencia a la salud, por la característica de sus viviendas, esparcidas a lo largo de los ríos y cursos de agua, y por la dificultad de acceso a los centros urbanos. Este estudio tuvo como objetivo investigar la infección causada por el HTLV en comunidades ribereñas del nordeste paraense, atendidas por el Programa Luz en la Amazonia, entre febrero de 2009 y junio de 2010. Fue realizada una investigación de anticuerpos anti-HTLV-1/2 en 175 ribereños, siendo 30 (17,14%) de la comunidad de São Pedro (Acará); 62 (35,43%) de la comunidad del Furo do Aurá (Belém) y 83 (47,43%) de Santa Maria (Acará). En los casos reactivos, se utilizaron métodos de biología molecular para confirmar la infección e identificar el tipo viral. La prevalencia total del HTLV-1 fue de 1,14% (2/175), variando entre cero (0/34) en São Pedro, 1,20% (1/83) en Santa Maria y 1,61% (1/62) en el Furo do Aurá. El HTLV-1 fue identificado en dos de las 117 (1,71%) familias analizadas de las tres comunidades. No se observó ningún caso de transmisión familiar en la muestra. El HTLV-2 no fue hallado en la muestra estudiada. Este estudio demostró la ocurrencia de HTLV-1 en las comunidades ribereñas estudiadas, con frecuencias similares a las de las poblaciones urbanas, indicando la necesidad de una mayor investigación y de acciones de prevención de las enfermedades asociadas al virus en esas comunidades.

Palabras clave: Deltaretrovirus; Estudios Transversales; Estudios Seroepidemiológicos; Prueba ELISA.


 

 

INTRODUÇÃO

Os vírus linfotrópicos humanos de células T (HTLV) pertencem à família Retroviridae, à subfamília Orthoretrovirinae e ao gênero Deltaretrovirus. Evidências epidemiológicas consistentes apontam o HTLV-1 como agente associado a doenças como: Leucemia/Linfoma de Células T do Adulto conhecida como LLTA ou ATL, Paraparesia Espástica Tropical/Mielopatia Associada ao HTLV-1 conhecida como PET/MAH ou TSP/HAM, uveíte e dermatite infectiva1,2,3. Quanto ao HTLV-2, raramente tem sido associado a essas doenças4. E apenas entre 1% e 4% dos indivíduos infectados irão desenvolver algum tipo de doença debilitante associada ao vírus5.

O HTLV ocorre em todo o mundo, mas sua distribuição varia de acordo com a região geográfica. O HTLV-1 é endêmico no Japão, Caribe, África, América do Sul e ilhas da Melanésia6. No Brasil, estima-se que 2,5 milhões de pessoas estejam infectadas. O vírus está presente em todos os Estados porém com prevalências variadas. A Cidade de Salvador apresenta a maior população de soropositivos para HTLV entre os doadores de sangue do Brasil7,8.

A transmissão desse vírus pode acontecer de quatro formas: por contato sexual; de mãe para filho, através da amamentação; por transfusão de sangue; e por meio de seringas e agulhas contendo células infectadas com o vírus2,7,8. O contato celular é necessário para que haja a transmissão eficiente entre células e indivíduos9. Estimativas apontam que, aproximadamente, de 10 a 20 milhões de pessoas estejam infectadas pelo HTLV-1 no mundo. A infecção por esse vírus tem período de latência prolongado, podendo durar algumas décadas ou toda a vida do indivíduo infectado7.

A maioria das comunidades ribeirinhas da Região Amazônica tem dificuldade para obter assistência de todo e qualquer tipo, principalmente de ações de saúde, pela característica de serem as famílias espalhadas em ilhas ou às margens de igarapés e furos (pequenos canais), sem acesso fácil aos centros urbanos. Este estudo identificou a frequência e distribuição do HTLV-1/2 em comunidades ribeirinhas, visando minimizar a propagação dessa infecção e a ocorrência de doenças associadas.

 

MATERIAIS E MÉTODOS

Entre fevereiro de 2009 e junho de 2010, o Programa Luz na Amazônia atendeu a três comunidades ribeirinhas, são elas: São Pedro e Santa Maria, no Município do Acará e a comunidade do Furo do Aurá, do Município de Belém. O referido programa é uma parceria entre a Sociedade Bíblica do Brasil (SBB) e a Universidade Federal do Pará (UFPA) e, com a ajuda de voluntários, desenvolve ações de promoção à saúde em comunidades ribeirinhas da região nordeste do Estado do Pará.

Uma investigação sorológica para HTLV foi realizada em famílias cadastradas nas três comunidades ribeirinhas atendidas no período do estudo, sendo 28 famílias da comunidade de São Pedro (com 30 indivíduos), 46 famílias da comunidade de Santa Maria (com 83 indivíduos) e 43 famílias do Furo do Aurá (com 62 indivíduos), correspondendo a um total de 175 indivíduos. Foram incluídos no estudo indivíduos de ambos os sexos, maiores de 18 anos de idade, residentes na comunidade, priorizando os representantes adultos de cada família.

Os ribeirinhos que se enquadraram nos critérios de inclusão foram orientados e convidados a participar do estudo, assinando o Termo de Consentimento Livre e Esclarecido. O projeto de pesquisa foi analisado e aprovado por Comitê de Ética em Pesquisa em Seres Humanos, segundo o protocolo de no 071/2006-CEP/NMT.

Palestras sobre os objetivos da investigação foram realizadas em todas as comunidades e as amostras de sangue foram obtidas após o consentimento de cada indivíduo. O questionário epidemiológico foi preenchido no momento da coleta da amostra sanguínea, identificando variáveis como a idade, o gênero, histórico de transfusões sanguíneas ou de hemoderivados e uso de drogas injetáveis, dentre outros. Todas as amostras de sangue coletadas foram testadas pelo método de ensaio imunoenzimático (ELISA), para a detecção de anticorpos anti-HTLV-1/2 (Ortho®, USA), de acordo com instruções do fabricante. As amostras com resultados reagentes e com valores próximos aos do cutoff, foram testadas em duplicata.

As amostras consideradas positivas pelo ELISA foram analisadas pela técnica de reação em cadeia da polimerase (PCR), seguida de digestão enzimática para confirmação da infecção e diferenciação dos tipos 1 e 2 de HTLV. A técnica emprega a detecção do DNA proviral pela amplificação da região Px do vírus. Para a reação de PCR foi utilizada solução com 5,0 µL de Go Taq® Green Master Mix, 2,0 µL de água, 1 µL (10 pmol) de cada primer HTLV_Externo F 5'-TTCCCAGGGTTTGGACGAAG-3' (7219-7238, direto) e HTLV_Externo R 5'-GGGTAAG GACCTTGAGGGTC-3' (7483-7464, reverso) e 1,0 µL de DNA, para um volume final de 10 µL. O protocolo para amplificação seguiu a temperatura de desnaturação de 94o C por 4 min, seguida de 30 ciclos (repetições), onde a temperatura de desnaturação foi de 94o C por 40 seg, a temperatura de anelamento a 51,6o C por 30 seg e, por fim, a temperatura de extensão a 72o C por 40 seg, seguida da temperatura de extensão final de 72o C, 10 min, e 10o C por 10 min10.

A identificação molecular do genoma viral foi realizada por uma nested-PCR, utilizando-se as mesmas quantidades de reagentes da primeira PCR e 1 µL (10 pmol) de cada primer HTLV_interno F 5'CGGATACCCAGT CTACGTGTT3' (7248-7268, direto) e HTLV_interno R 5'GAGCCGATAACGCGTCCATCG3' (7406-7386, reverso). O protocolo de amplificação seguiu-se em 35 ciclos (repetições), com temperatura de desnaturação de 94o C por 30 seg, a temperatura de anelamento de 51,6o C por 30 seg e a temperatura de extensão de 72o C por 30 seg, seguido da temperatura de extensão final a 72o C, 10 min, e 10o C por 10 min10.

Todas as amostras de DNA foram previamente amplificadas para um fragmento do gene da globina humana, utilizando as mesmas condições de reagentes, com exceção dos oligonucletídeos específicos para HPV, que foram substituídos pelos oligonucletídeos G73 e G7411. Foram utilizados controles positivo (amostra sabidamente positiva) e negativo (água estéril) a cada reação de PCR.

Após a identificação dos casos com resultados de PCR positivos, foi realizada a digestão enzimática destes, para identificar o tipo de HTLV presente na amostra. A reação enzimática utilizou a enzima Taq I (Promega®) seguindo as recomendações do fabricante. A cada reação enzimática foi utilizado um controle positivo para HTLV-2. Os produtos de PCR e de digestão enzimática foram visualizados em gel de agarose a 2% e a 3%, respectivamente, contendo brometo de etídio (1 mg/mL), sob luz UV.

Os comunicantes e familiares dos indivíduos confirmados com a infecção viral foram investigados quanto à transmissão familiar do HTLV-1/2, obedecendo aos critérios de investigação do cônjuge, mãe e filhos, quando a pessoa infectada fosse do sexo feminino; e cônjuge e mãe, quando fosse do sexo masculino.

 

RESULTADOS

A investigação sorológica para HTLV-1/2 foi realizada em 117 das 149 (78,52%) famílias cadastradas no Programa Luz na Amazônia, no período de janeiro de 2009 a junho de 2010, sendo 28 famílias da comunidade de São Pedro (30 indivíduos), 46 famílias de Santa Maria (83 indivíduos) e 43 do Furo do Aurá (62 indivíduos), correspondendo a um total de 175 indivíduos.

A tabela 1 por gênero, demonstra a distribuição, por faixa etária e da demanda de 175 ribeirinhos que participaram do estudo: idade variando de 18 a 85 anos e média de 41 anos; 93,14% (163/175) das pessoas com idade igual ou superior a 20 anos. Identificou-se também uma maior frequência, 58,28% (102/175), de indivíduos do sexo feminino na amostra analisada das três comunidades.

 

 

A presença de anticorpos anti-HTLV-1/2 foi identificada em duas das 175 amostras analisadas, caracterizando uma prevalência de 1,14%. A frequência de anticorpos variou de zero (0/30) na comunidade de São Pedro a 1,20% (1/83) na comunidade de Santa Maria e 1,61% (1/62) na comunidade do Furo do Aurá. As frequências de HTLV-1/2 não divergiram estatisticamente entre as três comunidades estudadas (p = 0,7525). Os dois indivíduos soropositivos tinham idade de 20 e 65 anos, sendo do sexo feminino e masculino, respectivamente.

Resultados da PCR confirmaram a amplificação do fragmento do genoma proviral do HTLV-1/2 nas duas amostras ELISA positivas e o tipo HTLV-1 foi identificado pela digestão enzimática em ambas as amostras, não tendo sido encontrado nenhum caso de HTLV-2.

A pesquisa de anticorpos anti-HTLV-1/2 nos familiares da mulher ribeirinha com infecção confirmada por HTLV-1 foi negativa. Desta família foram analisados seus dois filhos (com idades de dois e quatro anos), sua mãe e seu cônjuge. O outro caso, também positivo para HTLV-1, relatou ser viúvo, não ter pais vivos, não ter filhos e nem outro familiar residindo na mesma comunidade, impossibilitando a análise de seus comunicantes. Nenhum dos indivíduos infectados por HTLV-1 relatou história de transfusão sanguínea ou uso de drogas endovenosas.

 

DISCUSSÃO

A infecção pelo HTLV-1/2 se caracteriza pelo seu agrupamento em áreas geográficas definidas no mundo; pela variação espacial das taxas de soroprevalência, dentro de áreas de prevalência reconhecidamente elevadas; pelo aumento da soroprevalência com a idade (efeito da idade, efeito de coorte, soroconversão tardia); e soroprevalência mais elevada em mulheres, tornando-se mais acentuada após os 40 anos de idade10.

No Brasil, até o momento, não existem estudos epidemiológicos com bases populacionais e com metodologias adequadas sobre a infecção pelo HTLV que permitam conhecer sua real prevalência6. A principal maneira de aferição da prevalência da infecção tem sido realizada pela análise sorológica de doadores em bancos de sangue, onde as taxas encontradas nas capitais brasileiras variam de 0,04% em Florianópolis, Santa Catarina, a 1,80% em Salvador, Bahia7,8,12. A soroprevalência de HTLV-1/2 deste estudo, de 1,14%, encontra-se inserida na variação encontrada entre os doadores de sangue no Brasil e na variação de 0,91% a 1,61% encontrada nos doadores de sangue do Estado do Pará7,8.

Como os ensaios imunoenzimáticos estão sujeitos a frequentes reações falsopositivas13,14,15, o imunodiagnóstico do retrovírus depende de confirmação da sororreatividade por meio de Western Blot (WB) ou da PCR. Neste sentido, outros estudos demonstram prevalência de infecção pelo HTLV confirmada pela técnica do WB de 0,3% no interior da Bahia16, 0,11% em Rio Branco, Acre17, 0,07% em Maringá, Paraná18 e 0,02% em Uberaba, Minas Gerais19. Neste estudo, a infecção por HTLV-1 foi confirmada por métodos moleculares em todas as amostras sorologicamente reagentes para HTLV-1/2.

A alta prevalência da infecção por HTLV na Região Amazônica, especialmente no Estado do Pará, que se destaca como o terceiro em número de casos entre doadores de sangue do Brasil7,8, tem suscitado estudos soroepidemiológicos e moleculares direcionados para comunidades com populações específicas, já tendo sido registrada prevalência de 1,8% para HTLV-1, entre imigrantes japoneses20, e a variação de zero a 2,06% para HTLV-1 e de zero a 1,06% para HTLV-2 em comunidades remanescentes de quilombolas, na Ilha do Marajó (Pará, Brasil)21. O HTLV-2 também foi identificado em até 30% de comunidades indígenas amazônicas22 e em 29% das amostras sororreagentes de doadores paraenses, mas nas comunidades ribeirinhas objeto deste estudo só o HTLV-1 foi encontrado.

A variação na prevalência de HTLV de comunidades estudadas previamente, assim como neste estudo, demonstrou que o vírus ainda não penetrou em certas comunidades, onde provavelmente os fatores associados à exposição são menos frequentes. Por outro lado, considerando que são populações pequenas, a presença de uma única pessoa pode elevar esta prevalência a índices próximos ou acima dos encontrados na população em geral. Além disso, a partir do momento em que se encontra um caso positivo em uma comunidade fechada existe uma chance maior desse vírus se propagar de forma silenciosa, contribuindo para um aumento da infecção e das doenças associadas.

A partir da noção adquirida, em pesquisa anterior23, sobre a forma silenciosa com que o HTLV se propaga no seio das famílias, o presente trabalho objetivou também investigar a transmissão familiar da infecção entre os ribeirinhos, porém nenhum caso foi identificado na família investigada. Estudos epidemiológicos relatam um aumento da infecção com a idade, que pode ocorrer por soroconversão tardia de infecção adquirida no início da vida ou pelo risco cumulativo de novas infecções ao longo da vida24. Neste sentido, seria importante investigar os filhos do caso portador a posteriori, visto que ainda são crianças e que houve relato de amamentação natural por um longo período.

A amostra de famílias analisadas neste estudo é significativa para inferir dados estatísticos sobre as três comunidades estudadas e pode até representar a realidade das comunidades ribeirinhas localizadas próximas à Cidade de Belém, mas não deve demonstrar a prevalência da infecção pelo HTLV-1/2 na população de ribeirinhos do Estado do Pará, devido à grande diversidade dessa população, o que pode estar relacionado ou não aos fatores associados à infecção.

 

CONCLUSÃO

A prevalência do HTLV-1 na amostra de comunidades ribeirinhas investigadas foi de 1,14%, variando de zero a 1,61%, não tendo sido encontrado nenhum caso de HTLV-2 e também nenhum caso de transmissão familiar. Uma melhor visão sobre a prevalência da infecção por HTLV-1/2 na população ribeirinha do Estado do Pará seria obtida por um estudo epidemiológico de base populacional. Esse conhecimento é importante na prevenção de novas infecções e de doenças associadas a esses vírus.

 

APOIO FINANCEIRO

Este trabalho obteve suporte financeiro da Fundação de Amparo à Pesquisa do Estado do Pará (PPSUS-PA 2006-2007_PROJ_428_9577372), em colaboração com a UFPA e a SBB.

 

REFERÊNCIAS

1 Proietti FA, Carneiro-Proietti AB, Catalan-Soares BC, Murphy EL. Global epidemiology of HTLV-I infection and associated diseases. Oncogene. 2005 Sep;24(39):6058-68. DOI:10.1038/SJ.ONC.1208968         [ Links ]

2 Bittencourt AL. Vertical transmission of HTLV-I/II: a review. Rev Inst Med Trop Sao Paulo. 1998 Jul-Aug;40(4):245-51. DOI:10.1590/S0036-46651998000400008          [ Links ]

3 Spalton DJ, Nicholson F. HTLV-I infection in human disease. Br J Ophthalmol. 1991 Mar;75(3):174-5.         [ Links ]

4 Posada-Vergara MP, Montanheiro P, Fukumori LM, Bonasser F, Duarte AJ, Penalva de Oliveira AC, et al. Clinical and epidemiological aspects of HTLV-II infection in São Paulo, Brazil: presence of tropical spastic paraparesis/HTLV-associated myelopathy (TSP/HAM) simile diagnosis in HIV-1-co-infected subjects. Rev Inst Med Trop Sao Paulo. 2006 Jul-Aug;48(4):207-10. DOI:10.1590/S0036-46652006000400006         [ Links ]

5 Santos FLN, Lima FWM. Epidemiologia, fisiopatogenia e diagnóstico laboratorial da infecção pelo HTLV-I. J Bras Patol Med Lab. 2005 abr;41(2):105-16. DOI:10.1590/S1676-24442005000200008         [ Links ]

6 Gonçalves DU, Proietti FA, Ribas JG, Araújo MG, Pinheiro SR, Guedes AC, et al. Epidemiology, treatment, and prevention of human T-cell leukemia virus type 1-associated diseases. Clin Microbiol Rev. 2010 Jul;23(3):577-89.         [ Links ]

7 Carneiro-Proietti ABF, Ribas JGR, Catalan-Soares BC, Martins ML, Brito-Melo GEA, Mertins-Filho AO, et al. Infecção e doença pelos vírus linfotrópicos humanos de células T (HTLV-I/II) no Brasil. Rev Soc Bras Med Trop. 2002 set-out;35(5):499-508.         [ Links ]

8 Catalan-Soares B, Carneiro-Proietti AB, Proietti FA. Interdisciplinary HTLV Research Group. Heterogeneous geographic distribution of human T-cell lymphotropic viruses I and II (HTLV-I/II): serological screening prevalence rates in blood donors from large urban areas in Brazil. Cad Saude Publica. 2005 May-Jun;21(3):926-31. DOI:10.1590/S0102-311X2005000300027         [ Links ]

9 Igakura T, Stinchcombe JC, Goon PKC, Taylor GP, Weber JN, Griffiths GM, et al. Spread of HTLV-I between lymphocytes by virus-induced polarization of the cytoskeleton. Science. 2003 Mar;299(5613):1713-6.         [ Links ]

10 Tuke PW, Luton P, Garson JA. Differential diagnosis of HTLV-I and HTLV-II infections by restriction enzyme analysis of nested PCR productes. J Virol Methods. 1992 Nov;40(2):163-74. DOI: 10.1016/0166-0934(92)90065-L         [ Links ]

11 Greer CE, Peterson SL, Kiviat NB, Manos MM. PCR amplification from paraffin-embedded tissues: effects of fixative and fixation time. Am J Clin Pathol. 1991 Feb;95(2):117-24.         [ Links ]

12 Salles NA, Sabino EC, Barreto CB, Barreto AME, Otani MM, Chamone DF. Descarte de bolsas de sangue e prevalência de doenças infecciosas em doadores de sangue da Fundação Pró-Sangue/Hemocentro de São Paulo. Rev Panam Salud Publica. 2003 Feb-Mar;13(2-3):111-6. DOI:10.1590/S1020-49892003000200011         [ Links ]

13 Zehender G, Maddalena C, Gianotto M, Cavalli B, Santambrogio S, Orso M, et al. High prevalence of false-negative anti-HTLV type I/II enzyme-linked immunosorbent assay results in HIV type 1-positive patients. AIDS Res Hum Retroviruses. 1997 Sep;13(13):1141-6.         [ Links ]

14 Caterino-de-Araujo A, Chieco-Bianchi L, Meleiro MC, Suleiman J, Calabro ML, Favero A, et al. Sensitivity of two enzyme-linked immunosorbent assay tests in relation to western blot in detecting human T-cell lymphotropic virus types I and II infection among HIV-1 infected patients from São Paulo, Brazil. Diagn Microbiol Infect Dis. 1998 Mar;30(3):173-82. DOI:10.1016/S0732-8893(97)00236-8          [ Links ]

15 Poiesz BJ, Dube S, Choi D, Esteban E, Ferrer J, Leon­Ponte M, et al. Comparative performances of an HTLV-I/II EIA and other serologic and PCR assays on samples from persons at risk for HTLV-II infection. Transfusion. 2000 Aug;40(8):924-30. DOI:10.1046/j.1537-2995.2000.40080924.x         [ Links ]

16 Britto APCR, Galvão-Castro B, Straatmann A, Santos-Torres S, Tavares-Neto J. Infecção pelo HTLV-I/II no Estado da Bahia. Rev Soc Bras Med Trop. 1998 jan-fev;31(1):35-41. DOI: 10.1590/S0037-86821998000100005         [ Links ]

17 Colin DD, Alcântara Júnior LC, Santos FL, Uchôa R, Tavares-Neto J. Seroprevalence of human T cell lymphotropic virus infection and associated factors of risk in blood donors of Rio Branco city, AC, Brazil (1998-2001). Rev Soc Bras Med Trop. 2003 Nov-Dec;36(6):677-83.         [ Links ]

18 Veit APT, Mella EAC, Mella-Junior SE. Soroprevalência do vírus linfotrópico de células T humanas (HTLV-I/II) em indivíduos doadores de sangue do hemocentro da cidade de Maringá-PR. Arq Cienc Saude Unipar Umuarama. 2006 set-dez;10(3):123-6.         [ Links ]

19 Lima GM, Eustáquio JMJ, Martins RA, Josahkian JA, Pereira GA, Moraes-Souza H, et al. Decline in the prevalence of HTLV-1/2 among blood donors at the Regional Blood Center of the City of Uberaba, State of Minas Gerais, from 1995 to 2008. Rev Soc Bras Med Trop. 2010 Jul-Aug;43(4):421-4. DOI:10.1590/S0037-86822010000400017         [ Links ]

20 Vallinoto AC, Muto NA, Pontes GS, Machado LF, Azevedo VN, Santos SE, et al. Serological and molecular evidence of HTLV-I infection among Japanese immigrants living in the Amazon region of Brazil. Jpn J Infect Dis. 2004 Aug;57(4):156-9.         [ Links ]

21 Vallinoto AC, Pontes GS, Muto NA, Lopes IG, Machado LF, Azevedo VN, et al. Identification of human T-cell lymphotropic virus infection in a semi-isolated Afro-Brazilian quilombo located in the Marajó Island (Pará, Brazil). Mem Inst Oswaldo Cruz. 2006 Feb;101(1):103-5. DOI:10.1590/S0074-02762006000100020         [ Links ]

22 Ishak R, Harrington Jr WJ, Azevedo VN, Eiraku N, Ishak MO, Guerreiro JF, et al. Identification of human T cell lymphotropic virus type IIa infection in the Kayapo, an indigenous population of Brazil. AIDS Res Hum Retroviruses. 1995 Jul;11(7):813-21.         [ Links ]

23 Catalan-Soares B, Carneiro-Proietti AB, Proietti FA. Grupo Interdisciplinar de Pesquisas em HTLV. Human T-cell lymphotropic virus in family members of seropositive blood donors: silent dissemination. Rev Panam Salud Publica. 2004 Dec;16(6):387-94.         [ Links ]

24 Murphy EL, Wilks R, Morgan OS, Hanchard B, Cranston B, Figueroa JP, et al. Health effects of human T-lymphotropic virus type I (HTLV-I) in a Jamaican cohort. Int J Epidemiol. 1996;25(5):1090-7.         [ Links ]

 

 

Correspondência / Correspondence / Correspondencia:
Maísa Silva de Sousa
Núcleo de Medicina Tropical,
Universidade Federal do Pará
Av. Generalíssimo Deodoro, 92.
Bairro: Umarizal
CEP: 66055-240
Belém-Pará-Brasil
Tel./Fax: (91) 3241-4681
E-mail:maisasousa@ufpa.br

Recebido em / Received / Recibido en: 1/9/2010
Aceito em / Accepted / Aceito en: 25/9/2010