SciELO - Scientific Electronic Library Online

 
vol.7 número2Análise microbiológica do tambaqui (Colossoma macropomum) comercializado na feira municipal de Ariquemes, Estado de Rondônia, BrasilEscherichia coli enteropatogênica: uma categoria diarreiogênica versátil índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

  • Não possue artigos citadosCitado por SciELO

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Revista Pan-Amazônica de Saúde

versão impressa ISSN 2176-6223versão On-line ISSN 2176-6223

Rev Pan-Amaz Saude v.7 n.2 Ananindeua jun. 2016

http://dx.doi.org/10.5123/S2176-62232016000200009 

RELATO DE CASO

Presença de Mycobacterium leprae em escarro de paciente sintomático respiratório com hanseníase multibacilar

The presence of Mycobacterium leprae in sputum of respiratory symptomatic patient with multibacillary leprosy

Presencia de Mycobacterium leprae en esputo de paciente sintomático respiratorio con lepra multibacilar

Luana Nepomuceno Gondim Costa Lima1  , Maria Luíza Lopes1  , Maria do Perpétuo Socorro Amador Silvestre1  , Francisco Lúzio de Paula Ramos1  , Haroldo José de Matos1 

1Instituto Evandro Chagas/SVS/MS, Ananindeua, Pará, Brasil

RESUMO

Paciente com queixa principal de tosse produtiva crônica com três meses de duração e expectoração de muco purulento, perda de peso, falta de apetite, dispneia, dor na região torácica e cansaço, sendo ainda observados sintomas clínicos de hanseníase, índice baciloscópico da linfa de 4,25 e títulos de IgM anti-PGL-I positivos. Do escarro, pelo método de Ziehl-Neelsen, foram observados bacilos isolados e globias, com ausência de crescimento em Löwenstein-Jensen. Foi demonstrada amplificação do DNA de Mycobacterium leprae nas amostras de escarro e secreção nasal. Assim, ilustramos um caso sintomático de tuberculose e hanseníase, mas somente com hanseníase multibacilar, podendo ter ocorrido disseminação do M. leprae para os pulmões por contiguidade, uma vez que o bacilo é encontrado rotineiramente na nasofaringe.

Palavras-chave: Hanseníase; Escarro; Tuberculose

ABSTRACT

Patient with main complaints of chronic productive cough lasted three months and expectoration of purulent sputum, weight loss, loss of appetite, dyspnea, pain in the thoracic region and tiredness, clinical symptoms of leprosy, lymph index of 4.25 and positive IgM anti-PGL-I titers. Of the sputum, by using the Ziehl-Neelsen method, isolated bacilli and in groups with lack of growth in Löwenstein-Jensen were observed. It was shown DNA amplification of Mycobacterium leprae in the sputum samples and nasal secretion. It is demonstrated a symptomatic case of tuberculosis and leprosy, but only in multibacillary leprosy, so the dissemination by contiguity of M. leprae to the lungs can occur, once bacillus is frequently found in the nasopharynx.

Keywords: Leprosy; Sputum; Tuberculosis

RESUMEN

Paciente con queja principal de tos productiva crónica con tres meses de duración y expectoración de muco purulento, pérdida de peso, falta de apetito, disnea, dolor en la región torácica y cansancio, se observaron síntomas clínicos de lepra, índice baciloscópico de linfa de 4,25 y títulos de IgM anti-PGL-I positivos. Del esputo, por el método de Ziehl-Neelsen, se observaron bacilos aislados y globias, con ausencia de crecimiento en Löwenstein-Jensen. Se demostró una amplificación del ADN de Mycobacterium leprae en las muestras de esputo y secreción nasal. Así, ilustramos un caso sintomático de tuberculosis y lepra, solamente con lepra multibacilar, aunque puede haber habido diseminación de M. leprae para los pulmones por contigüidad, una vez que el bacilo se encuentra, normalmente, en la nasofaringe.

Palabras clave: Lepra; Esputo; Tuberculosis

INTRODUÇÃO

O Estado do Pará representou o quinto Estado do Brasil com maior taxa de prevalência (4,07/10.000) de hanseníase no ano de 2014, obtendo um coeficiente de detecção de 50,75/100.000. Belém, a capital do Estado, apresentou uma taxa de detecção considerada muito alta em 2014 (23,47/100.000), com 331 casos novos notificados1.

O envolvimento do trato respiratório na hanseníase há muito tempo vem sendo relatado. Nos estudos de Kaur et al2 e Barton3 foi relatado envolvimento nasal clinicamente em pacientes examinados. No estudo de Barton3, o local do trato respiratório mais envolvido foi a epiglote, enquanto no estudo de Kaur et al2 foram as cordas vocais. Desikan e Job4 encontraram granulomas lepromatosos na submucosa da laringe e Lie5 relatou espessamento da mucosa brônquica e traqueal.

Em alguns casos de coinfecção do Mycobacterium leprae e Mycobacterium tuberculosis, os sintomas respiratórios podem estar relacionados ao M. leprae, visto que existem relatos do comprometimento dos pulmões, traqueias e brônquios com produção de tosse e escarro causado pelo M. leprae2,3,4,5.

RELATO DO CASO

Paciente de 30 anos de idade, do sexo masculino, procedente de Belém, foi atendido no dia 11 de setembro de 2013 no Serviço de Atendimento Médico Unificado (SOAMU) do Instituto Evandro Chagas, em Ananindeua, Estado do Pará, com queixa principal de tosse crônica produtiva com três meses de duração e expectoração muco-purulenta, perda de peso, falta de apetite, dispneia, dor na região torácica e cansaço.

No exame clínico do paciente, foi observado que o mesmo apresentava hanseníase caracterizada por infiltrado auricular bilateral, múltiplas manchas hipocrômicas e hipercrômicas, hipoestésicas e anestésicas nos membros inferiores e superiores e parestesia nos membros inferiores há dois anos.

A baciloscopia da linfa dos dois lóbulos auriculares, cotovelo direito e tornozelo esquerdo foi realizada e corada pelo método de coloração de Ziehl-Neelsen, obtendo-se um índice baciloscópico (IB) de 4,25. A coleta de material do tornozelo para baciloscopia foi devido à lesão cutânea no tornozelo. Não houve estudo radiológico dos pulmões.

Da amostra de escarro, foi feita a pesquisa de bacilos álcool-ácido resistentes (BAAR) pelo método de coloração de Ziehl-Neelsen, sendo observados bacilos isolados e em globias, e a cultura em meio Löwenstein-Jensen com observação por 60 dias, sendo constatada ausência de crescimento.

Além das amostras de escarro, foram coletadas amostras de secreção nasal (SN) por meio de swab por rotação no anteposto externo do orifício nasal e duas amostras de 5 mL de sangue pela pulsão venosa.

As amostras de sangue foram utilizadas para dosagem de anticorpos antiglicolipídeo fenólico-1 (anti-PGL-I) e para anticorpos anti-HIV. A pesquisa de anticorpos da classe IgM anti-PGL-I foi realizada por meio de ensaio imunoenzimático (ELISA), utilizando-se antígeno semissintético (Japão, Nara XVII-48), porção terminal trissacáride imunogênica da cadeia do PGL-I, denominado pela sigla NT-P-BSA. Ambas as amostras foram positivas para PGL-I com densidade óptica de 0.459 e 0.774, respectivamente, e foram negativas para anti-HIV.

Para as amostras de escarro, SN e sangue, foi realizada extração de DNA utilizando o kit DNeasy Blood & Tissue (Qiagen, Duesseldorf, Alemanha), obedecendo as orientações do fabricante.

Foi realizada a amplificação do DNA das amostras de escarro e SN por meio da reação em cadeia da polimerase (PCR). Os iniciadores gyrAF (5'-3'- CCCGGACCGTAGCCACGCTAAGTC) e gyrAR (5'-3'- CATCGCTGCCGGTGGGTCATTA) foram desenhados com o programa Primer3 v0.4.0 a partir da região da subunidade A da girase do DNA do M. leprae (NC011896.1) para amplificar um fragmento de 187 pb6.

Para a realização da PCR, foi utilizado o kit Ilustra(tm) PuReTaq Ready-To-Go PCR Beads (GE Healthcare, EUA), seguindo as orientações do fabricante e os ciclos de temperatura: 94° C durante 5 min, seguido de seis ciclos a 94° C durante 45 s, 65° C durante 45 s e 72° C durante 90 s, mais 35 ciclos a 94° C durante 45 s, 62° C durante 45 s e 72° C durante 90 s com extensão final de 72° C por 10 min. Para a visualização do amplicon, foi feito eletroforese em gel de agarose 2,0% em TBE 1X, sendo observada a amplificação de DNA de M. leprae nas amostras de escarro e SN (Figura 1).

Figura 1 - Gel de agarose 2,0% em TBE 1X 

A partir do DNA extraído do sangue, para verificação de um genótipo favorável a fim de uma resposta celular ou humoral do paciente, foram tipificados os polimorfismos das principais citocinas envolvidas nessas respostas. Sendo tipificados os polimorfismos dos genes TNF-α (fator de necrose tumoral-α) -308 G→A; IFN-γ (interferon-γ) +874 T→A; IL-6 (interleucina-6) -174 G→C; IL-10 -1082 A→T, -819 C→T, -592 A→C e TGF-β (fator de crescimento tumoral-β) códon 10 e códon 25 pelo uso do kit PCYTOGENE (One-Lambda; Canoga Park, CA, EUA), seguindo as orientações do fabricante. Para visualização dos amplicons foi feito eletroforese em gel de agarose 1,5% em TBE 1X. Os genótipos encontrados foram TNF-α G/G, TGF-β T/C G/G, IL-10 GCC/ATA, IL-6 G/G, 14 e 15: IFN-γ T/A.

DISCUSSÃO

Os sintomas comuns da hanseníase são lesões de pele, tais como máculas hipocrômicas ou avermelhadas com alteração de sensibilidade, parestesias, madarose, úlceras, espessamento neural, nódulos e edema nos membros. Podem ocorrer sintomas respiratórios, no entanto a tosse com expectoração é rara e pode estar associada com o M. tuberculosis, devido à coinfecção com o M. leprae7. Porém, Muir8 destacou que na hanseníase a infiltração nodular da traqueia e dos brônquios podem romper, ocorrendo uma alta liberação de BAAR e produção de escarro, levando a um falso diagnóstico de tuberculose pulmonar.

Como já demonstrado que a prevalência da coinfecção do M. leprae e M. tuberculosis em regiões endêmicas de hanseníase não é incomum9,10, no caso relatado suspeitou-se de coinfecção de hanseníase e tuberculose, pois o paciente apresentava alguns sintomas característicos da tuberculose, como tosse crônica, inicialmente seca, evoluindo para a produção de escarro esverdeado, mal estar, perda de peso, falta de apetite, dificuldade respiratória e cansaço. A tuberculose pode ocorrer durante todo o espectro da hanseníase ou após o uso de corticoterapia7,11.

Com o objetivo de descartar a suspeita de coinfecção, foi realizada a cultura da amostra de escarro em meio Löwenstein-Jensen com observação por 60 dias, sendo constatada ausência de crescimento. Também foi constatado que o paciente ficou curado, sem sintomas respiratórios, após o tratamento com clofazimina, rifampicina e dapsona durante um ano.

Corroborando que o M. leprae era a causa dos sintomas respiratórios, a PCR da amostra de escarro foi positiva para o M. leprae e foram observadas globias na lâmina. Poucos estudos conseguiram comprovar a presença de M. leprae no escarro12,13, sendo observada uma carência de estudos mais recentes na literatura que abordem casos sintomáticos respiratórios na hanseníase.

Kaur et al2 estudaram pacientes hansenianos com tosse e expectoração de muco e concluíram que a abundância de células secretoras de muco seria devido ao hábito de fumar, visto que 60% desses pacientes eram fumantes e, em um paciente com evidências radiológicas de tuberculose, a cultura em meio Löwenstein-Jensen foi negativa. O paciente deste estudo não era fumante.

A detecção do DNA do M. leprae por PCR no auxílio da prática clínica da hanseníase é bem relatada na elucidação do diagnóstico da hanseníase indeterminada e neural em pacientes com sinais clínicos de hanseníase, mas sem confirmação pela baciloscopia, ELISA e histopatologia, em casos de difícil diagnóstico e no diagnóstico precoce de contatos de pacientes14, sendo neste estudo demonstrado que a PCR pode ser utilizada para a diferenciação rápida de M. tuberculosis e M. leprae presente no escarro quando os sintomas são inconclusivos para coinfecção.

O exame clínico, o resultado do anti-PGL-I e do IB, demonstraram que o paciente era multibacilar. As diferenças de densidade óptica no ELISA (0.459 e 0.774) devem-se às diferentes datas em que foram feitas as sensibilizações das placas.

A genotipagem de citocinas envolvidas na resposta celular revelou um perfil genético não favorável à resposta celular Th1 (células T helper 1), a qual teria efeito protetor contra a hanseníase.

As citocinas exercem importante papel nas respostas celular e humoral do paciente com hanseníase, sendo a primeira relacionada à hanseníase paucibacilar e a segunda relacionada à hanseníase multibacilar. A variabilidade genética de genes de citocinas traduz a complexidade de diferenças individuais na resposta imune a patógenos15,16. O paciente do presente estudo apresentou genótipo TNF-α G/G e IFN-γ T/A, os quais, segundo o fabricante do kit, representam baixa e intermediária produção da citocina, respectivamente, enquanto seria necessária uma produção elevada de ambas as citocinas para contenção da infecção. O IFN-γ age sobre macrófagos, estimulando a fagocitose e os mecanismos de ativação celular, levando a maior produção de TNF-α que incrementa a ativação macrofágica, atuando por meio de um mecanismo sinérgico cíclico15,16.

Neste estudo, os genótipos do paciente TGF-β T/C G/G, IL-10 GCC/ATA, IL-6 G/G, segundo o fabricante do kit, representam alta, intermediária e alta produção da citocina, respectivamente, o que pode caracterizar uma inativação da resposta celular e favorecimento de uma resposta humoral. O TGF-β tem ação supressora sobre macrófagos, inibição da produção de TNF-α e diminuição da produção de IFN-γ, dessa forma podendo contribuir para a perpetuação da infecção. A IL-10 é supressora da atividade macrofágica e relacionada à inibição da liberação de citocinas com propriedades antibacterianas. A IL-6 participa na diferenciação e na maturação das células B em células secretoras de anticorpos15,16.

CONCLUSÃO

Foi relatado um caso sintomático de tuberculose e hanseníase, mas somente com hanseníase multibacilar, no qual foi constatada a presença do M. leprae no escarro do paciente por baciloscopia e PCR que pode ter sido decorrente da contaminação da secreção ao longo das vias aéreas superiores ou devido à disseminação do M. leprae para os pulmões por contiguidade, uma vez que o bacilo é encontrado rotineiramente na nasofaringe.

Devido à hanseníase e à tuberculose serem de alta prevalência na Região Norte, deve-se investigar a coinfecção com M. tuberculosis e M. leprae em todos os pacientes com manifestações clínicas dermatológicas e pulmonares alusivas dessas enfermidades. A necessidade de profissionais treinados na rede de saúde é importante para se evitar um falso diagnóstico da tuberculose em pacientes hansenianos com sintomas respiratórios, evitando-se também um tratamento inadequado e prejudicial.

REFERÊNCIAS

1 Ministério da Saúde (BR). Departamento de Informática do SUS. Datasus [Internet]. Brasília: Ministério da Saúde; 2014 [citado 2014 set 20]. Disponível em: Disponível em: http://datasus.saude.gov.br/ . [ Links ]

2 Kaur S, Malik SK, Kumar B, Singh MP, Chakravarty RN. Respiratory system involvement in leprosy. Int J Lepr Other Mycobact Dis. 1979;47(1):18-25. [Link] [ Links ]

3 Barton RPE. A clinical study of the nose in lepromatous leprosy. Lepr Rev. 1974 Jun;45(2):135-44. [ Links ]

4 Desikan KV, Job CK. Visceral lesions caused by M. leprae: a histopathological study. Indian J Pathol Bacteriol. 1970 Jul;13(3):100-8. [ Links ]

5 Lie HP. Tracheitis and bronchitis leprosa. Int J Lepr. 1936 Jul-Sep;4(3):281-8. [Link] [ Links ]

6 Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA, editors. Bioinformatics methods and protocols. Totowa: Humana Press; 1999. p. 365-86. (Methods in molecular biology; 132). [Link] [ Links ]

7 Waghray DP, Tummuru VR, Rao AK, Reddy VV. Concomitant active pulmonary tuberculosis and lepromatous leprosy with type-II lepra reaction in same patient. J Evol Med Dent Sci. 2013 Sep;2(36):6880-5. [Link] [ Links ]

8 Muir E. Leprosy of the lungs. Lepr India. 1933;5:72. [ Links ]

9 Donoghue HD, Marcsik A, Matheson C, Vernon K, Nuorala E, Molto JE. Co-infection of Mycobacterium tuberculosis and Mycobacterium leprae in human archaeological samples: a possible explanation for the historical decline of leprosy. Proc Biol Sci. 2005 Feb;272(1561):389-94. Doi: 10.1098/rspb.2004.2966 [Link] [ Links ]

10 Rajagopala S, Devaraj U, D'Souza G, Aithal VV. Co-infection with M. tuberculosis and M. leprae-case report and systematic review. J Mycobac Dis. 2012 Jun;2(4):1-5. Doi: 10.4172/2161-1068.1000118 [Link] [ Links ]

11 Chaussinand R. Tuberculose et lepre, maladies antagoniques: eviction de la lepre par la tuberculose. Int J Lepr. 1948;16(4):431-8. [Link] [ Links ]

12 Sapkota BR, Ranjit C, Macdonald M. Rapid differentiation of Mycobacterium tuberculosis and Mycobacterium leprae from sputum by polymerase chain reaction. Nepal Med Coll J. 2007 Mar;9(1):12-6. [Link] [ Links ]

13 Edwards LJ, Price RN, Krause VL, Huffam SE, Globan M, Fyfe J, et al. Detection of Mycobacterium leprae by PCR testing of sputa from a patient with pulmonary cryptococcus coinfection in Northern Australia. J Clin Microbiol. 2014 Oct;52(10):3811-2. Doi: 10.1128/JCM.01060-14 [Link] [ Links ]

14 Martinez AN, Talhari C, Moraes MO, Talhari S. PCR-based techniques for leprosy diagnosis: from the laboratory to the clinic. PLoS Negl Trop Dis. 2014 Apr;8(4):e2655-63. Doi: 10.1371/journal.pntd.0002655 [Link] [ Links ]

15 Lima LNGC, Frota CC, Freitas MVC, Câmara LMC, Rodrigues LC, Barreto ML, et al. Cytokine polymorphisms and susceptibility to leprosy. Rev Bras Med. 2013 Oct;70(10):1-6. [Link] [ Links ]

16 Jarduli LR, Sell AM, Reis PG, Sippert EA, Ayo CM, Mazini PS, et al. Role of HLA, KIR, MICA, and cytokines genes in leprosy. Biomed Res Int. 2013;2013(ID 989837):1-17. Doi: 10.1155/2013/989837 [Link] [ Links ]

Recebido: 11 de Junho de 2015; Aceito: 19 de Fevereiro de 2016

Correspondência / Correspondence / Correspondencia: Luana Nepomuceno Gondim Costa Lima. Laboratório de Biologia Molecular, Seção de Bacteriologia e Micologia, Instituto Evandro Chagas/SVS/MS, Rodovia BR-316 km 7, s/n, Bairro: Levilândia. CEP: 67030-000. Ananindeua-Pará-Brasil. Tel.: +55 (91) 3214-2116. E-mail: luanalima@iec.pa.gov.br

Creative Commons License Este é um artigo publicado em acesso aberto sob uma licença Creative Commons