INTRODUCTION
The genus Biomphalaria Preston, 1910 includes mollusks that may transmit Schistosoma mansoni, the etiological agent of schistosomiasis in Brazil. Among the 11 species and one subspecies of Biomphalaria genus that occur in the country, three are regarded as intermediate hosts of S. mansoni: Biomphalaria glabrata (Say, 1818), Biomphalaria tenagophila (d'Orbigny, 1835), and Biomphalaria straminea (Dunker, 1848). In Pará State, the species B. glabrata, B. straminea, Biomphalaria schrammi (Crosse, 1864), and Biomphalaria kuhniana (Clessin, 1883) have been already reported1.
The determination of species of the genus Biomphalaria is based on the comparison of morphological characters of shell, excretory system, and reproductive organs2; however, this can be difficult due to size of the specimens, inadequate fixation processes, and interspecific similarities3. These similarities even culminated in the grouping of some species of the genus Biomphalaria in two complexes: 1) B. straminea composed by B. straminea, Biomphalaria intermedia (Paraense & Deslandes, 1962), and B. kuhniana; and 2) B. tenagophila containing B. tenagophila, Biomphalaria tenagophila guaibensis Paraense, 1984, and Biomphalaria occidentalis Paraense, 19814,5,6,7. The species of B. tenagophila complex are indistinguishable from shell morphology and the majority of organs of the genital system. And only B. tenagophila is susceptible to infection with S. mansoni; therefore, the identification of these species is important for epidemiological studies of schistosomiasis7, and the knowledge of the geographical distribution of these species enable better resource distribution and adequate policies for the mollusk control8. The molecular taxonomy has been used as an auxiliary tool to morphology when it is not enough for the species identification.
The present work aimed to report the first occurrence of B. occidentalis in Pará State, Northern Region of Brazil.
MATERIALS AND METHODS
Malacological surveys were carried out in May 2017 in the municipality of Afuá, Mesorregião Marajó, in Pará State, latitude 00º09'20.1"S and longitude 50º23'02.9"W.
Five specimens were collected using tongs and nets at sewage ditches from the urban perimeter containing garbage, by the collection period of 30 min. No other species of mollusks or vegetation were observed in the sewage ditches during this time. The environment characteristics, where the specimens were collected, were favorable to the occurrence and dispersion of mollusks. A Garmin GPSMAP® 76CS Global Positioning System (GPS) receiver was used to record the geographic coordinates reading and all collection points were annotated and georeferenced.
The mollusks obtained were wrapped in gauze soaked in water, inserted in properly identified plastic bags, and stored in a rigid container in which they were transported to Laboratory of Intestinal Parasites, Schistosomiasis, and Malacology (LPIEM) of Parasitology Section (SAPAR) of Instituto Evandro Chagas (IEC). Five specimens were measured and individually packed in glass containers with 20 mL of dechlorinated water, exposed to artificial light (60 W incandescent lamp) for 30 min, and then examined under a stereomicroscope to verify the presence of S. mansoni cercariae9. Subsequently, the mollusks were sacrificed, fixed10,11, and the foot of each specimen removed for DNA extraction by modified Wizard Genomic DNA Purification Kit (Promega).
The mollusks were identified morphologically by comparison of characters of the shell and the male and female reproductive organs according to Paraense2,4,5.
Molecular identification was performed by Laboratory of Helminthology and Medical Malacology, Instituto René Rachou/Fiocruz, using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) of the internal transcribed spacer (ITS) region of the RNA ribosomal genes, where the entire ITS was amplified with the primers ETTS2 (5' TAACAAGGTTTCCGTAGGTGAA 3') and ETTS1 (5' TGCTTAAGTTCAGCGGGT 3') anchored respectively in the conserved extremities of the 18S and 28S ribosomal genes12. Subsequent was carried out cleavage of this fragment with the restriction enzymes DdeI and AluI7,13.
RESULTS
All specimens that were examined for the presence of S. mansoni cercariae were negative for the parasite and for other trematodes larvae.
All mollusks were morphologically identified as B. occidentalis (Figure 1).

A: Shell; B: Reproductive system; C: Mantle with renal tube.
Figure 1 - Biomphalaria sp. from Afuá, Pará State, Brazil
The molecular results showing restriction profiles obtained by digestion of the ITS region of DNA ribosomal with DdeI were compared to the pattern of DNA profiles obtained from the Biomphalaria and Helisoma mollusks tissue from the Medical Malacology Collection (Fiocruz/CMM) (Figure 2).

Lane 1: Biomphalaria sp. from Afuá, Pará State; Lane 2: B. occidentalis from Belo Horizonte, Minas Gerais State; Lanes 3 and 4: Helisoma sp. from Três Lagoas, Mato Grosso do Sul State; Lane 5: B. glabrata from Belo Horizonte, Minas Gerais State; Lane 6: B. tenagophila from Sabará, Minas Gerais State; Lane 7: Biomphalaria peregrina from Coromandel, Minas Gerais State. The numbers on the left of the gel are the value in base pairs (bp) of the molecular size markers Phi X 174/HaeIII.
Figure 2 - Silver stained polyacrylamide gel (6%) showing restriction profiles obtained by digestion of the ITS region of DNA ribosomal with Ddel
To differentiate the species, the amplicon, previously obtained of approximately 1,200 base pairs, was submitted to a new RFLP using the restriction enzyme AluI7, being possible to define the specie as B. occidentalis by molecular technique (Figure 3).

Lane 1: B. tenagophila from Sabará, Minas Gerais State; Lanes 2 and 3: B. t. guaibensis from Santa Vitória do Palmar, Rio Grande do Sul State; Lane 4: Biomphalaria sp. from Afuá, Pará State; Lanes 5 and 6: B. occidentalis from Belo Horizonte, Minas Gerais State. The numbers on the left of the gel are the value in base pairs (bp) of the molecular size markers Phi X 174/HaeIII.
Figure 3 - Silver stained polyacrylamide gel (6%) showing restriction profiles obtained by digestion of the ITS region of DNA ribosomal with Alul
DISCUSSION
The geographic distribution of planorbid mollusks in Brazil is not well known due to the great territorial extension and the lack of human and economic resources; however, the number of studies aiming to better know the malacological fauna in some regions has increased14,15.
The present study is the first report of B. occidentalis in Pará State. In Brazil, this species was already found in Acre, Mato Grosso, Mato Grosso do Sul, Minas Gerais, Paraná, Rio Grande do Sul, Rondônia, Santa Catarina, São Paulo States, and there are reports of shells in Amazonas too1,4,16.
The freshwater mollusks B. occidentalis, B. tenagophila, and B. t. guaibensis are morphologically similar, grouped in the complex B. tenagophila. Despite the morphological similarity among the species of the complex, only B. tenagophila is susceptible to S. mansoni, and several studies reinforced B. occidentalis as refractory species17,18,19; therefore the differentiation of these species is important to establish the vulnerable areas to the risk of occurrence of the schistosomiasis.
Studies of the planorbid fauna in all areas of Brazil, mainly in less investigated regions, should be motivated by the objective of knowing the geographic distribution of Biomphalaria mollusks aiming the better resource distribution and adequate surveillance for its control.










text in 
Curriculum ScienTI

